Del C. Torre-La

Guadalajara, JAL 44100, Mexico

Last Updated: 09/26/2026

Save publications for later

Sign Up

Not sure about your diagnosis?

Check Your Symptoms

Found 10 publications

Bidirectional Interactions Between Cervicovaginal Microbiota and Human Papillomavirus Drive Persistence and Disease Progression.

Bidirectional Interactions Between Cervicovaginal Microbiota and Human Papillomavirus Drive Persistence and Disease Progression.

Journal: International journal of molecular sciences

Published: April 16, 2026

Lead Poisoning in the Americas: Sources, Regulations, Health Impacts, and Molecular Mechanisms.

Lead Poisoning in the Americas: Sources, Regulations, Health Impacts, and Molecular Mechanisms.

Journal: Journal of xenobiotics

Published: May 30, 2025

Uric Acid Correlates with Serum Levels of Mineral Bone Metabolism and Inflammation Biomarkers in Patients with Stage 3a-5 Chronic Kidney Disease.

Uric Acid Correlates with Serum Levels of Mineral Bone Metabolism and Inflammation Biomarkers in Patients with Stage 3a-5 Chronic Kidney Disease.

Journal: Medicina (Kaunas, Lithuania)

Published: October 15, 2024

Association of KLOTHO gene variants with metabolic and renal function parameters in Mexican patients living with type 2 diabetes.

Association of KLOTHO gene variants with metabolic and renal function parameters in Mexican patients living with type 2 diabetes.

Journal: Journal of diabetes and metabolic disorders

Published: December 20, 2023

The Genetic Variant TNFA (rs361525) Is Associated with Increased Susceptibility to Developing Dengue Symptoms.

The Genetic Variant TNFA (rs361525) Is Associated with Increased Susceptibility to Developing Dengue Symptoms.

Journal: Viral immunology

Published: February 02, 2023

Low expression of E-Cadherin and CDH1 variants associated with diffuse gastric cancer.

Low expression of E-Cadherin and CDH1 variants associated with diffuse gastric cancer.

Journal: Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion

Published: January 18, 2023

Role of the BMP6 protein in breast cancer and other types of cancer.

Role of the BMP6 protein in breast cancer and other types of cancer.

Journal: Growth factors (Chur, Switzerland)

Published: October 28, 2021

Predicting Pathogenicity of CDH1 Gene Variants in Patients with Early-onset Diffuse Gastric Cancer from Western Mexico.

Predicting Pathogenicity of CDH1 Gene Variants in Patients with Early-onset Diffuse Gastric Cancer from Western Mexico.

Journal: Revista de investigacion clinica; organo del Hospital de Enfermedades de la Nutricion

Published: January 19, 2021

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Journal: International journal of laboratory hematology

Published: September 27, 2016

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

Journal: International journal of laboratory hematology

Published: September 22, 2015

Showing 1-10 of 10

Last Updated: 09/26/2026